Antibodies
Anti-PCCB Antibody-Oligo Conjugate
SKU: aoc3030
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PCCB Antibody-IF1
Antibody Target
- Target
- Propionyl-CoA carboxylase beta chain, mitochondrial
- UniProt Number
- P05166
- Target Description
- This is one of the 2 subunits of the biotin-dependent propionyl-CoA carboxylase (PCC), a mitochondrial enzyme involved in the catabolism of odd chain fatty acids, branched-chain amino acids isoleucine, threonine, methionine, and valine and other metabolites. Propionyl-CoA carboxylase catalyzes the carboxylation of propionyl-CoA/propanoyl-CoA to D-methylmalonyl-CoA/(S)-methylmalonyl-CoA. Within the holoenzyme, the alpha subunit catalyzes the ATP-dependent carboxylation of the biotin carried by the biotin carboxyl carrier (BCC) domain, while the beta subunit then transfers the carboxyl group from carboxylated biotin to propionyl-CoA. Propionyl-CoA carboxylase also significantly acts on butyryl-CoA/butanoyl-CoA, which is converted to ethylmalonyl-CoA/(2S)-ethylmalonyl-CoA at a much lower rate. Other alternative minor substrates include (2E)-butenoyl-CoA/crotonoyl-CoA.
- Molecular Weight
- 58kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC64902
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat