Antibodies
Anti-PCIF1 Antibody-Oligo Conjugate
SKU: aoc3031
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PCIF1 Antibody-IF1
Antibody Target
- Target
- mRNA
- UniProt Number
- Q9H4Z3
- Target Description
- Cap-specific adenosine methyltransferase that catalyzes formation of N(6),2'-O-dimethyladenosine cap (m6A(m)) by methylating the adenosine at the second transcribed position of capped mRNAs. Recruited to the early elongation complex of RNA polymerase II (RNAPII) via interaction with POLR2A and mediates formation of m6A(m) co-transcriptionally.
- Molecular Weight
- 81kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCIPELISA
- Clone
- ARC64786
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat