Antibodies
Anti-PCNA Antibody-Oligo Conjugate
SKU: aoc3033
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PCNA Antibody-IF1
Antibody Target
- Target
- Proliferating cell nuclear antigen
- UniProt Number
- P12004
- Target Description
- Auxiliary protein of DNA polymerase delta and epsilon, is involved in the control of eukaryotic DNA replication by increasing the polymerase's processibility during elongation of the leading strand. Induces a robust stimulatory effect on the 3'-5' exonuclease and 3'-phosphodiesterase, but not apurinic-apyrimidinic (AP) endonuclease, APEX2 activities. Has to be loaded onto DNA in order to be able to stimulate APEX2. Plays a key role in DNA damage response (DDR) by being conveniently positioned at the replication fork to coordinate DNA replication with DNA repair and DNA damage tolerance pathways. Acts as a loading platform to recruit DDR proteins that allow completion of DNA replication after DNA damage and promote postreplication repair: Monoubiquitinated PCNA leads to recruitment of translesion (TLS) polymerases, while 'Lys-63'-linked polyubiquitination of PCNA is involved in error-free pathway and employs recombination mechanisms to synthesize across the lesion.
- Molecular Weight
- 29kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC51324
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRatAfrican green monkey