Antibodies
Anti-PD-L1 Antibody-Oligo Conjugate
SKU: aoc3047
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PD-L1 Antibody-IF1
Antibody Target
- Target
- Programmed cell death 1 ligand 1
- UniProt Number
- Q9NZQ7
- Target Description
- Plays a critical role in induction and maintenance of immune tolerance to self. As a ligand for the inhibitory receptor PDCD1/PD-1, modulates the activation threshold of T-cells and limits T-cell effector response. Through a yet unknown activating receptor, may costimulate T-cell subsets that predominantly produce interleukin-10 (IL10). Can also act as a transcription coactivator: in response to hypoxia, translocates into the nucleus via its interaction with phosphorylated STAT3 and promotes transcription of GSDMC, leading to pyroptosis.; FUNCTION: The PDCD1-mediated inhibitory pathway is exploited by tumors to attenuate anti-tumor immunity and escape destruction by the immune system, thereby facilitating tumor survival. The interaction with PDCD1/PD-1 inhibits cytotoxic T lymphocytes (CTLs) effector function. The blockage of the PDCD1-mediated pathway results in the reversal of the exhausted T-cell phenotype and the normalization of the anti-tumor response, providing a rationale for cancer immunotherapy.
- Molecular Weight
- 33kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISAInhibition
- Clone
- ARC5146-01
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human