Antibodies
Anti-PDGF Receptor alpha Antibody-Oligo Conjugate
SKU: aoc3041
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PDGF Receptor alpha Antibody-IF1
Antibody Target
- Target
- Platelet-derived growth factor receptor alpha
- UniProt Number
- P16234
- Target Description
- Tyrosine-protein kinase that acts as a cell-surface receptor for PDGFA, PDGFB and PDGFC and plays an essential role in the regulation of embryonic development, cell proliferation, survival and chemotaxis. Depending on the context, promotes or inhibits cell proliferation and cell migration. Plays an important role in the differentiation of bone marrow-derived mesenchymal stem cells. Required for normal skeleton development and cephalic closure during embryonic development. Required for normal development of the mucosa lining the gastrointestinal tract, and for recruitment of mesenchymal cells and normal development of intestinal villi. Plays a role in cell migration and chemotaxis in wound healing. Plays a role in platelet activation, secretion of agonists from platelet granules, and in thrombin-induced platelet aggregation. Binding of its cognate ligands - homodimeric PDGFA, homodimeric PDGFB, heterodimers formed by PDGFA and PDGFB or homodimeric PDGFC -leads to the activation of several signaling cascades; the response depends on the nature of the bound ligand and is modulated by the formation of heterodimers between PDGFRA and PDGFRB. Phosphorylates PIK3R1, PLCG1, and PTPN11. Activation of PLCG1 leads to the production of the cellular signaling molecules diacylglycerol and inositol 1,4,5-trisphosphate, mobilization of cytosolic Ca(2+) and the activation of protein kinase C. Phosphorylates PIK3R1, the regulatory subunit of phosphatidylinositol 3-kinase, and thereby mediates activation of the AKT1 signaling pathway. Mediates activation of HRAS and of the MAP kinases MAPK1/ERK2 and/or MAPK3/ERK1. Promotes activation of STAT family members STAT1, STAT3 and STAT5A and/or STAT5B. Receptor signaling is down-regulated by protein phosphatases that dephosphorylate the receptor and its down-stream effectors, and by rapid internalization of the activated receptor.
- Molecular Weight
- 123kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCIPELISA
- Clone
- ARC3294
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat