Antibodies

Anti-PDGF Receptor beta Antibody-Oligo Conjugate

SKU: aoc3042

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-PDGF Receptor beta Antibody-IF1

Antibody Target

Target
Platelet-derived growth factor receptor beta
UniProt Number
P09619
Target Description
Tyrosine-protein kinase that acts as a cell-surface receptor for homodimeric PDGFB and PDGFD and for heterodimers formed by PDGFA and PDGFB, and plays an essential role in the regulation of embryonic development, cell proliferation, survival, differentiation, chemotaxis and migration. Plays an essential role in blood vessel development by promoting proliferation, migration and recruitment of pericytes and smooth muscle cells to endothelial cells. Plays a role in the migration of vascular smooth muscle cells and the formation of neointima at vascular injury sites. Required for normal development of the cardiovascular system. Required for normal recruitment of pericytes (mesangial cells) in the kidney glomerulus, and for normal formation of a branched network of capillaries in kidney glomeruli. Promotes rearrangement of the actin cytoskeleton and the formation of membrane ruffles. Binding of its cognate ligands - homodimeric PDGFB, heterodimers formed by PDGFA and PDGFB or homodimeric PDGFD -leads to the activation of several signaling cascades; the response depends on the nature of the bound ligand and is modulated by the formation of heterodimers between PDGFRA and PDGFRB. Phosphorylates PLCG1, PIK3R1, PTPN11, RASA1/GAP, CBL, SHC1 and NCK1. Activation of PLCG1 leads to the production of the cellular signaling molecules diacylglycerol and inositol 1,4,5-trisphosphate, mobilization of cytosolic Ca(2+) and the activation of protein kinase C. Phosphorylation of PIK3R1, the regulatory subunit of phosphatidylinositol 3-kinase, leads to the activation of the AKT1 signaling pathway. Phosphorylation of SHC1, or of the C-terminus of PTPN11, creates a binding site for GRB2, resulting in the activation of HRAS, RAF1 and down-stream MAP kinases, including MAPK1/ERK2 and/or MAPK3/ERK1. Promotes phosphorylation and activation of SRC family kinases. Promotes phosphorylation of PDCD6IP/ALIX and STAM. Receptor signaling is down-regulated by protein phosphatases that dephosphorylate the receptor and its down-stream effectors, and by rapid internalization of the activated receptor.
Molecular Weight
124kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBICCELISA
Clone
ARC0009
Isotype
IgG
Form
Liquid
Immunogen
Synthetic peptide. This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
HumanMouse