Antibodies
Anti-PDIA6 Antibody-Oligo Conjugate
SKU: aoc3044
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PDIA6 Antibody-IF1
Antibody Target
- Target
- Protein disulfide-isomerase A6
- UniProt Number
- Q15084
- Target Description
- May function as a chaperone that inhibits aggregation of misfolded proteins. Negatively regulates the unfolded protein response (UPR) through binding to UPR sensors such as ERN1, which in turn inactivates ERN1 signaling. May also regulate the UPR via the EIF2AK3 UPR sensor. Plays a role in platelet aggregation and activation by agonists such as convulxin, collagen and thrombin.
- Molecular Weight
- 48kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC0944
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat