Antibodies
Anti-PDLIM1/CLP36 Antibody-Oligo Conjugate
SKU: aoc3048
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PDLIM1/CLP36 Antibody-IF1
Antibody Target
- Target
- PDZ and LIM domain protein 1
- UniProt Number
- O00151
- Target Description
- Cytoskeletal protein that may act as an adapter that brings other proteins (like kinases) to the cytoskeleton. Involved in assembly, disassembly and directioning of stress fibers in fibroblasts. Required for the localization of ACTN1 and PALLD to stress fibers. Required for cell migration and in maintaining cell polarity of fibroblasts.
- Molecular Weight
- 36kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC2379
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse