Antibodies
Anti-PDXK Antibody-Oligo Conjugate (ARC68527)
SKU: aoc3050
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PDXK Antibody (ARC68527)-IF1
Antibody Target
- Target
- Pyridoxal kinase
- UniProt Number
- O00764
- Target Description
- Catalyzes the phosphorylation of the dietary vitamin B6 vitamers pyridoxal (PL), pyridoxine (PN) and pyridoxamine (PM) to form pyridoxal 5'-phosphate (PLP), pyridoxine 5'-phosphate (PNP) and pyridoxamine 5'-phosphate (PMP), respectively (Probable). PLP is the active form of vitamin B6, and acts as a cofactor for over 140 different enzymatic reactions.
- Molecular Weight
- 27kDa/32kDa/35kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC68527
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- MouseRat