Antibodies
Anti-PEN2 Antibody-Oligo Conjugate
SKU: aoc3054
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PEN2 Antibody-IF1
Antibody Target
- Target
- Gamma-secretase subunit PEN-2
- UniProt Number
- Q9NZ42
- Target Description
- Essential subunit of the gamma-secretase complex, an endoprotease complex that catalyzes the intramembrane cleavage of integral membrane proteins such as Notch receptors and APP (amyloid-beta precursor protein). The gamma-secretase complex plays a role in Notch and Wnt signaling cascades and regulation of downstream processes via its role in processing key regulatory proteins, and by regulating cytosolic CTNNB1 levels (Probable). PSENEN modulates both endoproteolysis of presenilin and gamma-secretase activity.
- Molecular Weight
- 12kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PELISA
- Clone
- ARC1779
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat