Antibodies
Anti-PERK Antibody-Oligo Conjugate
SKU: aoc3062
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PERK Antibody-IF1
Antibody Target
- Target
- Eukaryotic translation initiation factor 2-alpha kinase 3
- UniProt Number
- Q9NZJ5
- Target Description
- Metabolic-stress sensing protein kinase that phosphorylates the alpha subunit of eukaryotic translation initiation factor 2 (EIF2S1/eIF-2-alpha) in response to various stress, such as unfolded protein response (UPR). Key effector of the integrated stress response (ISR) to unfolded proteins: EIF2AK3/PERK specifically recognizes and binds misfolded proteins, leading to its activation and EIF2S1/eIF-2-alpha phosphorylation. EIF2S1/eIF-2-alpha phosphorylation in response to stress converts EIF2S1/eIF-2-alpha in a global protein synthesis inhibitor, leading to a global attenuation of cap-dependent translation, while concomitantly initiating the preferential translation of ISR-specific mRNAs, such as the transcriptional activators ATF4 and QRICH1, and hence allowing ATF4- and QRICH1-mediated reprogramming. The EIF2AK3/PERK-mediated unfolded protein response increases mitochondrial oxidative phosphorylation by promoting ATF4-mediated expression of COX7A2L/SCAF1, thereby increasing formation of respiratory chain supercomplexes. In contrast to most subcellular compartments, mitochondria are protected from the EIF2AK3/PERK-mediated unfolded protein response due to EIF2AK3/PERK inhibition by ATAD3A at mitochondria-endoplasmic reticulum contact sites. In addition to EIF2S1/eIF-2-alpha, also phosphorylates NFE2L2/NRF2 in response to stress, promoting release of NFE2L2/NRF2 from the BCR(KEAP1) complex, leading to nuclear accumulation and activation of NFE2L2/NRF2. Serves as a critical effector of unfolded protein response (UPR)-induced G1 growth arrest due to the loss of cyclin-D1 (CCND1). Involved in control of mitochondrial morphology and function.
- Molecular Weight
- 125kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIHCELISA
- Clone
- ARC72901
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat