Antibodies
Anti-PERP Antibody-Oligo Conjugate
SKU: aoc3070
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PERP Antibody-IF1
Antibody Target
- Target
- p53 apoptosis effector related to PMP-22
- UniProt Number
- Q96FX8
- Target Description
- Component of intercellular desmosome junctions. Plays a role in stratified epithelial integrity and cell-cell adhesion by promoting desmosome assembly. Thereby plays a role in barrier function of the skin against infection. Plays a role in mammary epithelial tissue homeostasis and remodeling during and after pregnancy, potentially via its involvement in desmosome cell-cell junctions. Required for tooth enamel development via facilitating desmosome-mediated ameloblast adhesion to the stratum intermedium during the transitional stage of amelogenesis. May also play a role in downstream transcriptional regulation of other genes involved in amelogenesis such as AMBN, ENAM, MMP20 and KLK4. Plays a role as an effector in the TP53-dependent apoptotic pathway. Positively regulates apoptosis in T-helper 17 (Th17) cell populations via caspase-dependent signaling. Promotes neutrophil transepithelial migration in response to chemoattractants such as hepoxilin A3 (HXA3), N-Formylmethionyl-leucyl-phenylalanine (fMLP) and CXCL8/IL-8. Required for neutrophil transepithelial migration in response to S.typhimurium infection. May act as a positive regulator of endothelial cell apoptosis in response to blood flow-derived shear stress.
- Molecular Weight
- 21kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC2094
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat