Antibodies
Anti-PF4 Antibody-Oligo Conjugate
SKU: aoc3073
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PF4 Antibody-IF1
Antibody Target
- Target
- Platelet factor 4
- UniProt Number
- P02776
- Target Description
- Chemokine released during platelet aggregation that plays a role in different biological processes including hematopoiesis, cell proliferation, differentiation, and activation. Acts via different functional receptors including CCR1, CXCR3A or CXCR3B. Upon interaction with CXCR3A receptor, induces activated T-lymphocytes migration mediated via downstream Ras/extracellular signal-regulated kinase (ERK) signaling. Neutralizes the anticoagulant effect of heparin by binding more strongly to heparin than to the chondroitin-4-sulfate chains of the carrier molecule. Plays a role in the inhibition of hematopoiesis and in the maintenance of hematopoietic stem cell (HSC) quiescence. Chemotactic for neutrophils and monocytes via CCR1. Inhibits endothelial cell proliferation. In cooperation with toll-like receptor 8/TLR8, induces chromatin remodeling and activates inflammatory gene expression via the TBK1-IRF5 axis. In addition, induces myofibroblast differentiation and collagen synthesis in different precursor cells, including endothelial cells, by stimulating endothelial-to-mesenchymal transition. Interacts with thrombomodulin/THBD to enhance the activation of protein C and thus potentiates its anticoagulant activity.
- Molecular Weight
- 11kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC2076
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat