Antibodies
Anti-PFDN5 Antibody-Oligo Conjugate
SKU: aoc3074
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PFDN5 Antibody-IF1
Antibody Target
- Target
- Prefoldin subunit 5
- UniProt Number
- Q99471
- Target Description
- Binds specifically to cytosolic chaperonin (c-CPN) and transfers target proteins to it. Binds to nascent polypeptide chain and promotes folding in an environment in which there are many competing pathways for nonnative proteins. Represses the transcriptional activity of MYC.
- Molecular Weight
- 17 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-PELISA
- Clone
- ARC2111
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat