Antibodies
Anti-PFKL Antibody-Oligo Conjugate
SKU: aoc3076
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PFKL Antibody-IF1
Antibody Target
- Target
- ATP-dependent 6-phosphofructokinase, liver type
- UniProt Number
- P17858
- Target Description
- Catalyzes the phosphorylation of D-fructose 6-phosphate to fructose 1,6-bisphosphate by ATP, the first committing step of glycolysis. Negatively regulates the phagocyte oxidative burst in response to bacterial infection by controlling cellular NADPH biosynthesis and NADPH oxidase-derived reactive oxygen species. Upon macrophage activation, drives the metabolic switch toward glycolysis, thus preventing glucose turnover that produces NADPH via pentose phosphate pathway.
- Molecular Weight
- 85kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC61079
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat