Antibodies
Anti-PGAM5 Antibody-Oligo Conjugate
SKU: aoc3080
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PGAM5 Antibody-IF1
Antibody Target
- Target
- Serine/threonine-protein phosphatase PGAM5, mitochondrial
- UniProt Number
- Q96HS1
- Target Description
- Mitochondrial serine/threonine phosphatase that dephosphorylates various substrates and thus plays a role in different biological processes including cellular senescence or mitophagy. Modulates cellular senescence by regulating mitochondrial dynamics. Mechanistically, participates in mitochondrial fission through dephosphorylating DNM1L/DRP1. Additionally, dephosphorylates MFN2 in a stress-sensitive manner and consequently protects it from ubiquitination and degradation to promote mitochondrial network formation. Regulates mitophagy independent of PARKIN by interacting with and dephosphorylating FUNDC1, which interacts with LC3. Regulates anti-oxidative response by forming a tertiary complex with KEAP1 and NRF2. Regulates necroptosis by acting as a RIPK3 target and recruiting the RIPK1-RIPK3-MLKL necrosis 'attack' complex to mitochondria.
- Molecular Weight
- 32kDa/28KDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC53895
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human