Antibodies
Anti-PGP9.5 Antibody-Oligo Conjugate (ARC50371)
SKU: aoc3086
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PGP9.5 Antibody (ARC50371)-IF1
Antibody Target
- Target
- Ubiquitin carboxyl-terminal hydrolase isozyme L1
- UniProt Number
- P09936
- Target Description
- Deubiquitinase that plays a role in the regulation of several processes such as maintenance of synaptic function, cardiac function, inflammatory response or osteoclastogenesis. Abrogates the ubiquitination of multiple proteins including WWTR1/TAZ, EGFR, HIF1A and beta-site amyloid precursor protein cleaving enzyme 1/BACE1. In addition, recognizes and hydrolyzes a peptide bond at the C-terminal glycine of ubiquitin to maintain a stable pool of monoubiquitin that is a key requirement for the ubiquitin-proteasome and the autophagy-lysosome pathways. Regulates amyloid precursor protein/APP processing by promoting BACE1 degradation resulting in decreased amyloid beta production. Plays a role in the immune response by regulating the ability of MHC I molecules to reach cross-presentation compartments competent for generating Ag-MHC I complexes. Mediates the 'Lys-48'-linked deubiquitination of the transcriptional coactivator WWTR1/TAZ leading to its stabilization and inhibition of osteoclastogenesis. Deubiquitinates and stabilizes epidermal growth factor receptor EGFR to prevent its degradation and to activate its downstream mediators. Modulates oxidative activity in skeletal muscle by regulating key mitochondrial oxidative proteins. Enhances the activity of hypoxia-inducible factor 1-alpha/HIF1A by abrogateing its VHL E3 ligase-mediated ubiquitination and consequently inhibiting its degradation.
- Molecular Weight
- 25 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIF-FIF-PIHCELISA
- Clone
- ARC50371
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRatMonkey