Antibodies
Anti-PHD3 Antibody-Oligo Conjugate
SKU: aoc3090
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PHD3 Antibody-IF1
Antibody Target
- Target
- Prolyl hydroxylase EGLN3
- UniProt Number
- Q9H6Z9
- Target Description
- Prolyl hydroxylase that mediates hydroxylation of proline residues in target proteins, such as PKM, TELO2, ATF4 and HIF1A. Target proteins are preferentially recognized via a LXXLAP motif. Cellular oxygen sensor that catalyzes, under normoxic conditions, the post-translational formation of 4-hydroxyproline in hypoxia-inducible factor (HIF) alpha proteins. Hydroxylates a specific proline found in each of the oxygen-dependent degradation (ODD) domains (N-terminal, NODD, and C-terminal, CODD) of HIF1A. Also hydroxylates HIF2A. Has a preference for the CODD site for both HIF1A and HIF2A. Hydroxylation on the NODD site by EGLN3 appears to require prior hydroxylation on the CODD site. Hydroxylated HIFs are then targeted for proteasomal degradation via the von Hippel-Lindau ubiquitination complex. Under hypoxic conditions, the hydroxylation reaction is attenuated allowing HIFs to escape degradation resulting in their translocation to the nucleus, heterodimerization with HIF1B, and increased expression of hypoxy-inducible genes. ELGN3 is the most important isozyme in limiting physiological activation of HIFs (particularly HIF2A) in hypoxia. Also hydroxylates PKM in hypoxia, limiting glycolysis. Under normoxia, hydroxylates and regulates the stability of ADRB2. Regulator of cardiomyocyte and neuronal apoptosis. In cardiomyocytes, inhibits the anti-apoptotic effect of BCL2 by disrupting the BAX-BCL2 complex. In neurons, has a NGF-induced proapoptotic effect, probably through regulating CASP3 activity. Also essential for hypoxic regulation of neutrophilic inflammation. Plays a crucial role in DNA damage response (DDR) by hydroxylating TELO2, promoting its interaction with ATR which is required for activation of the ATR/CHK1/p53 pathway. Also mediates hydroxylation of ATF4, leading to decreased protein stability of ATF4 (Probable).
- Molecular Weight
- 27kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC52452
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse