Antibodies

Anti-Phospho-CDK2-T160 Antibody-Oligo Conjugate

SKU: aoc3985

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-Phospho-CDK2-T160 Antibody-IF1

Antibody Target

Target
Cyclin-dependent kinase 2
UniProt Number
P24941
Target Description
Serine/threonine-protein kinase involved in the control of the cell cycle; essential for meiosis, but dispensable for mitosis. Phosphorylates CABLES1, CTNNB1, CDK2AP2, ERCC6, NBN, USP37, p53/TP53, NPM1, CDK7, RB1, BRCA2, MYC, NPAT, EZH2. Triggers duplication of centrosomes and DNA. Acts at the G1-S transition to promote the E2F transcriptional program and the initiation of DNA synthesis, and modulates G2 progression; controls the timing of entry into mitosis/meiosis by controlling the subsequent activation of cyclin B/CDK1 by phosphorylation, and coordinates the activation of cyclin B/CDK1 at the centrosome and in the nucleus. Crucial role in orchestrating a fine balance between cellular proliferation, cell death, and DNA repair in embryonic stem cells (ESCs). Activity of CDK2 is maximal during S phase and G2; activated by interaction with cyclin E during the early stages of DNA synthesis to permit G1-S transition, and subsequently activated by cyclin A2 (cyclin A1 in germ cells) during the late stages of DNA replication to drive the transition from S phase to mitosis, the G2 phase. EZH2 phosphorylation promotes H3K27me3 maintenance and epigenetic gene silencing. Cyclin E/CDK2 prevents oxidative stress-mediated Ras-induced senescence by phosphorylating MYC. Involved in G1-S phase DNA damage checkpoint that prevents cells with damaged DNA from initiating mitosis; regulates homologous recombination-dependent repair by phosphorylating BRCA2, this phosphorylation is low in S phase when recombination is active, but increases as cells progress towards mitosis. In response to DNA damage, double-strand break repair by homologous recombination a reduction of CDK2-mediated BRCA2 phosphorylation. Involved in regulation of telomere repair by mediating phosphorylation of NBN. Phosphorylation of RB1 disturbs its interaction with E2F1. NPM1 phosphorylation by cyclin E/CDK2 promotes its dissociates from unduplicated centrosomes, thus initiating centrosome duplication. Cyclin E/CDK2-mediated phosphorylation of NPAT at G1-S transition and until prophase stimulates the NPAT-mediated activation of histone gene transcription during S phase. Required for vitamin D-mediated growth inhibition by being itself inactivated. Involved in the nitric oxide- (NO) mediated signaling in a nitrosylation/activation-dependent manner. USP37 is activated by phosphorylation and thus triggers G1-S transition. CTNNB1 phosphorylation regulates insulin internalization. Phosphorylates FOXP3 and negatively regulates its transcriptional activity and protein stability. Phosphorylates ERCC6 which is essential for its chromatin remodeling activity at DNA double-strand breaks. Acts as a regulator of the phosphatidylinositol 3-kinase/protein kinase B signal transduction by mediating phosphorylation of the C-terminus of protein kinase B (PKB/AKT1 and PKB/AKT2), promoting its activation.
Molecular Weight
34kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBIF-PIHCELISA
Clone
ARC57167
Isotype
IgG
Form
Liquid
Immunogen
Synthetic peptide. This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
HumanMouseRat