Antibodies
Anti-Phospho-CEBPB-T235 Antibody-Oligo Conjugate
SKU: aoc3991
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Phospho-CEBPB-T235 Antibody-IF1
Antibody Target
- Target
- CCAAT/enhancer-binding protein beta
- UniProt Number
- P17676
- Target Description
- Important transcription factor regulating the expression of genes involved in immune and inflammatory responses. Also plays a significant role in adipogenesis, as well as in the gluconeogenic pathway, liver regeneration, and hematopoiesis. The consensus recognition site is 5'-T[TG]NNGNAA[TG]-3'. Its functional capacity is governed by protein interactions and post-translational protein modifications. During early embryogenesis, plays essential and redundant roles with CEBPA. Has a promitotic effect on many cell types such as hepatocytes and adipocytes but has an antiproliferative effect on T-cells by repressing MYC expression, facilitating differentiation along the T-helper 2 lineage. Binds to regulatory regions of several acute-phase and cytokines genes and plays a role in the regulation of acute-phase reaction and inflammation. Also plays a role in intracellular bacteria killing. During adipogenesis, is rapidly expressed and, after activation by phosphorylation, induces CEBPA and PPARG, which turn on the series of adipocyte genes that give rise to the adipocyte phenotype. The delayed transactivation of the CEBPA and PPARG genes by CEBPB appears necessary to allow mitotic clonal expansion and thereby progression of terminal differentiation. Essential for female reproduction because of a critical role in ovarian follicle development. Restricts osteoclastogenesis: together with NFE2L1; represses expression of DSPP during odontoblast differentiation.; FUNCTION: [Isoform 2]: Essential for gene expression induction in activated macrophages. Plays a major role in immune responses such as CD4(+) T-cell response, granuloma formation and endotoxin shock. Not essential for intracellular bacteria killing.; FUNCTION: [Isoform 3]: Acts as a dominant negative through heterodimerization with isoform 2. Promotes osteoblast differentiation and osteoclastogenesis.
- Molecular Weight
- 36kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC72936
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat