Antibodies
Anti-Phospho-Cofilin-S3 Antibody-Oligo Conjugate
SKU: aoc3950
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Phospho-Cofilin-S3 Antibody-IF1
Antibody Target
- Target
- Cofilin-1
- UniProt Number
- P23528
- Target Description
- Binds to F-actin and exhibits pH-sensitive F-actin depolymerizing activity. In conjunction with the subcortical maternal complex (SCMC), plays an essential role for zygotes to progress beyond the first embryonic cell divisions via regulation of actin dynamics. Required for the centralization of the mitotic spindle and symmetric division of zygotes. Plays a role in the regulation of cell morphology and cytoskeletal organization in epithelial cells. Required for the up-regulation of atypical chemokine receptor ACKR2 from endosomal compartment to cell membrane, increasing its efficiency in chemokine uptake and degradation. Required for neural tube morphogenesis and neural crest cell migration.
- Molecular Weight
- 19 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIHCELISA
- Clone
- ARC78558
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat