Antibodies
Anti-Phospho-DRP1-S616 Antibody-Oligo Conjugate
SKU: aoc4085
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-Phospho-DRP1-S616 Antibody-PLA1
Antibody Target
- Target
- Dynamin-1-like protein
- UniProt Number
- O00429
- Target Description
- Functions in mitochondrial and peroxisomal division. Mediates membrane fission through oligomerization into membrane-associated tubular structures that wrap around the scission site to constrict and sever the mitochondrial membrane through a GTP hydrolysis-dependent mechanism. The specific recruitment at scission sites is mediated by membrane receptors like MFF, MIEF1 and MIEF2 for mitochondrial membranes. While the recruitment by the membrane receptors is GTP-dependent, the following hydrolysis of GTP induces the dissociation from the receptors and allows DNM1L filaments to curl into closed rings that are probably sufficient to sever a double membrane. Acts downstream of PINK1 to promote mitochondrial fission in a PRKN-dependent manner. Plays an important role in mitochondrial fission during mitosis. Through its function in mitochondrial division, ensures the survival of at least some types of postmitotic neurons, including Purkinje cells, by suppressing oxidative damage. Required for normal brain development, including that of cerebellum. Facilitates developmentally regulated apoptosis during neural tube formation. Required for a normal rate of cytochrome c release and caspase activation during apoptosis; this requirement may depend upon the cell type and the physiological apoptotic cues. Required for formation of endocytic vesicles. Proposed to regulate synaptic vesicle membrane dynamics through association with BCL2L1 isoform Bcl-X(L) which stimulates its GTPase activity in synaptic vesicles; the function may require its recruitment by MFF to clathrin-containing vesicles. Required for programmed necrosis execution. Rhythmic control of its activity following phosphorylation at Ser-637 is essential for the circadian control of mitochondrial ATP production.; FUNCTION: [Isoform 1]: Inhibits peroxisomal division when overexpressed.; FUNCTION: [Isoform 4]: Inhibits peroxisomal division when overexpressed.
- Molecular Weight
- 82kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISA
- Clone
- ARC74413
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat