Antibodies
Anti-Phospho-EGFR-Y845 Antibody-Oligo Conjugate
SKU: aoc3926
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Phospho-EGFR-Y845 Antibody-IF1
Antibody Target
- Target
- Epidermal growth factor receptor
- UniProt Number
- P00533
- Target Description
- Receptor tyrosine kinase binding ligands of the EGF family and activating several signaling cascades to convert extracellular cues into appropriate cellular responses. Known ligands include EGF, TGFA/TGF-alpha, AREG, epigen/EPGN, BTC/betacellulin, epiregulin/EREG and HBEGF/heparin-binding EGF. Ligand binding triggers receptor homo- and/or heterodimerization and autophosphorylation on key cytoplasmic residues. The phosphorylated receptor recruits adapter proteins like GRB2 which in turn activates complex downstream signaling cascades. Activates at least 4 major downstream signaling cascades including the RAS-RAF-MEK-ERK, PI3 kinase-AKT, PLCgamma-PKC and STATs modules. May also activate the NF-kappa-B signaling cascade. Also directly phosphorylates other proteins like RGS16, activating its GTPase activity and probably coupling the EGF receptor signaling to the G protein-coupled receptor signaling. Also phosphorylates MUC1 and increases its interaction with SRC and CTNNB1/beta-catenin. Positively regulates cell migration via interaction with CCDC88A/GIV which retains EGFR at the cell membrane following ligand stimulation, promoting EGFR signaling which triggers cell migration. Plays a role in enhancing learning and memory performance. Plays a role in mammalian pain signaling (long-lasting hypersensitivity).; FUNCTION: Isoform 2 may act as an antagonist of EGF action.; FUNCTION: (Microbial infection) Acts as a receptor for hepatitis C virus (HCV) in hepatocytes and facilitates its cell entry. Mediates HCV entry by promoting the formation of the CD81-CLDN1 receptor complexes that are essential for HCV entry and by enhancing membrane fusion of cells expressing HCV envelope glycoproteins.
- Molecular Weight
- 134kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC65597
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human