Antibodies
Anti-Phospho-ErbB4/HER4-Y1284 Antibody-Oligo Conjugate
SKU: aoc3943
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Phospho-ErbB4/HER4-Y1284 Antibody-IF1
Antibody Target
- Target
- Receptor tyrosine-protein kinase erbB-4
- UniProt Number
- Q15303
- Target Description
- Tyrosine-protein kinase that plays an essential role as cell surface receptor for neuregulins and EGF family members and regulates development of the heart, the central nervous system and the mammary gland, gene transcription, cell proliferation, differentiation, migration and apoptosis. Required for normal cardiac muscle differentiation during embryonic development, and for postnatal cardiomyocyte proliferation. Required for normal development of the embryonic central nervous system, especially for normal neural crest cell migration and normal axon guidance. Required for mammary gland differentiation, induction of milk proteins and lactation. Acts as cell-surface receptor for the neuregulins NRG1, NRG2, NRG3 and NRG4 and the EGF family members BTC, EREG and HBEGF. Ligand binding triggers receptor dimerization and autophosphorylation at specific tyrosine residues that then serve as binding sites for scaffold proteins and effectors. Ligand specificity and signaling is modulated by alternative splicing, proteolytic processing, and by the formation of heterodimers with other ERBB family members, thereby creating multiple combinations of intracellular phosphotyrosines that trigger ligand- and context-specific cellular responses. Mediates phosphorylation of SHC1 and activation of the MAP kinases MAPK1/ERK2 and MAPK3/ERK1. Isoform JM-A CYT-1 and isoform JM-B CYT-1 phosphorylate PIK3R1, leading to the activation of phosphatidylinositol 3-kinase and AKT1 and protect cells against apoptosis. Isoform JM-A CYT-1 and isoform JM-B CYT-1 mediate reorganization of the actin cytoskeleton and promote cell migration in response to NRG1. Isoform JM-A CYT-2 and isoform JM-B CYT-2 lack the phosphotyrosine that mediates interaction with PIK3R1, and hence do not phosphorylate PIK3R1, do not protect cells against apoptosis, and do not promote reorganization of the actin cytoskeleton and cell migration. Proteolytic processing of isoform JM-A CYT-1 and isoform JM-A CYT-2 gives rise to the corresponding soluble intracellular domains (4ICD) that translocate to the nucleus, promote nuclear import of STAT5A, activation of STAT5A, mammary epithelium differentiation, cell proliferation and activation of gene expression. The ERBB4 soluble intracellular domains (4ICD) colocalize with STAT5A at the CSN2 promoter to regulate transcription of milk proteins during lactation. The ERBB4 soluble intracellular domains can also translocate to mitochondria and promote apoptosis.
- Molecular Weight
- 147 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC67036
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human