Antibodies
Anti-Phospho-HDAC4-S246 + HDAC5-S259 + HDAC9-S220 Antibody-Oligo Conjugate
SKU: aoc3884
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Phospho-HDAC4-S246 + HDAC5-S259 + HDAC9-S220 Antibody-IF1
Antibody Target
- Target
- Histone deacetylase 4
- UniProt Number
- P56524
- Additional Target Information
- This antibody also binds Histone deacetylase 5, Uniprot:Q9UQL6. This antibody also binds Histone deacetylase 9, Uniprot:Q9UKV0.
- Target Description
- Responsible for the deacetylation of lysine residues on the N-terminal part of the core histones (H2A, H2B, H3 and H4). Histone deacetylation gives a tag for epigenetic repression and plays an important role in transcriptional regulation, cell cycle progression and developmental events. Histone deacetylases act via the formation of large multiprotein complexes. Involved in muscle maturation via its interaction with the myocyte enhancer factors such as MEF2A, MEF2C and MEF2D. Involved in the MTA1-mediated epigenetic regulation of ESR1 expression in breast cancer. Deacetylates HSPA1A and HSPA1B at 'Lys-77' leading to their preferential binding to co-chaperone STUB1.
- Molecular Weight
- 57-65 kDa/97-122 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC56536
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat