Antibodies
Anti-phospho-LATS1-T1079+LATS2-T1041 Antibody-Oligo Conjugate
SKU: aoc3894
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-phospho-LATS1-T1079+LATS2-T1041 Antibody-IF1
Antibody Target
- Target
- Serine/threonine-protein kinase LATS1
- UniProt Number
- O95835
- Additional Target Information
- This antibody also binds Serine/threonine-protein kinase LATS2, Uniprot:Q9NRM7.
- Target Description
- Negative regulator of YAP1 in the Hippo signaling pathway that plays a pivotal role in organ size control and tumor suppression by restricting proliferation and promoting apoptosis. The core of this pathway is composed of a kinase cascade wherein STK3/MST2 and STK4/MST1, in complex with its regulatory protein SAV1, phosphorylates and activates LATS1/2 in complex with its regulatory protein MOB1, which in turn phosphorylates and inactivates YAP1 oncoprotein and WWTR1/TAZ. Phosphorylation of YAP1 by LATS1 inhibits its translocation into the nucleus to regulate cellular genes important for cell proliferation, cell death, and cell migration. Acts as a tumor suppressor which plays a critical role in maintenance of ploidy through its actions in both mitotic progression and the G1 tetraploidy checkpoint. Negatively regulates G2/M transition by down-regulating CDK1 kinase activity. Involved in the control of p53 expression. Affects cytokinesis by regulating actin polymerization through negative modulation of LIMK1. May also play a role in endocrine function. Plays a role in mammary gland epithelial cell differentiation, both through the Hippo signaling pathway and the intracellular estrogen receptor signaling pathway by promoting the degradation of ESR1. Acts as an activator of the NLRP3 inflammasome by mediating phosphorylation of 'Ser-265' of NLRP3 following NLRP3 palmitoylation, promoting NLRP3 activation by NEK7.
- Molecular Weight
- 76kDa/126kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIHCELISA
- Clone
- ARC65149
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat