Antibodies
Anti-Phospho-MDM2-S166 Antibody-Oligo Conjugate
SKU: aoc4105
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Phospho-MDM2-S166 Antibody-IF1
Antibody Target
- Target
- E3 ubiquitin-protein ligase Mdm2
- UniProt Number
- Q00987
- Target Description
- E3 ubiquitin-protein ligase that mediates ubiquitination of p53/TP53, leading to its degradation by the proteasome. Inhibits p53/TP53- and p73/TP73-mediated cell cycle arrest and apoptosis by binding its transcriptional activation domain. Also acts as a ubiquitin ligase E3 toward itself and ARRB1. Permits the nuclear export of p53/TP53. Promotes proteasome-dependent ubiquitin-independent degradation of retinoblastoma RB1 protein. Inhibits DAXX-mediated apoptosis by inducing its ubiquitination and degradation. Component of the TRIM28/KAP1-MDM2-p53/TP53 complex involved in stabilizing p53/TP53. Also a component of the TRIM28/KAP1-ERBB4-MDM2 complex which links growth factor and DNA damage response pathways. Mediates ubiquitination and subsequent proteasome degradation of DYRK2 in nucleus. Ubiquitinates IGF1R and SNAI1 and promotes them to proteasomal degradation. Ubiquitinates DCX, leading to DCX degradation and reduction of the dendritic spine density of olfactory bulb granule cells. Ubiquitinates DLG4, leading to proteasomal degradation of DLG4 which is required for AMPA receptor endocytosis. Negatively regulates NDUFS1, leading to decreased mitochondrial respiration, marked oxidative stress, and commitment to the mitochondrial pathway of apoptosis. Binds NDUFS1 leading to its cytosolic retention rather than mitochondrial localization resulting in decreased supercomplex assembly (interactions between complex I and complex III), decreased complex I activity, ROS production, and apoptosis.
- Molecular Weight
- 55kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- IHCELISA
- Clone
- ARC2909
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat