Antibodies
Anti-Phospho-PKC (pan) (βII Ser660) Antibody-Oligo Conjugate
SKU: aoc4089
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Phospho-PKC (pan) (βII Ser660) Antibody-IF1
Antibody Target
- Target
- Protein kinase C alpha type (P17252)
- UniProt Number
- P17252
- Additional Target Information
- This antibody also binds Protein kinase C beta type, Uniprot:P05771. This antibody also binds Protein kinase C delta type, Uniprot:Q05655. This antibody also binds Protein kinase C epsilon type, Uniprot:Q02156. This antibody also binds Protein kinase C eta type, Uniprot:P24723. This antibody also binds Protein kinase C theta type, Uniprot:Q04759.
- Molecular Weight
- 59kDa/67kDa/74- 83kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC58577
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat