Antibodies

Anti-Phospho-PPP1CA-T320 Antibody-Oligo Conjugate

SKU: aoc3993

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-Phospho-PPP1CA-T320 Antibody-IF1

Antibody Target

Target
Serine/threonine-protein phosphatase PP1-alpha catalytic subunit
UniProt Number
P62136
Target Description
Protein phosphatase that associates with over 200 regulatory proteins to form highly specific holoenzymes which dephosphorylate hundreds of biological targets. Protein phosphatase 1 (PP1) is essential for cell division, transcription elongation, and participates in the regulation of glycogen metabolism, muscle contractility and protein synthesis. Involved in regulation of ionic conductances and long-term synaptic plasticity. May play an important role in dephosphorylating substrates such as the postsynaptic density-associated Ca(2+)/calmodulin dependent protein kinase II. Catalytic component of the PNUTS-PP1 protein phosphatase complex, a protein phosphatase 1 (PP1) complex that promotes RNA polymerase II transcription pause-release, allowing transcription elongation: the PNUTS-PP1 complex mediates the release of RNA polymerase II from promoter-proximal region of genes by catalyzing dephosphorylation of proteins involved in transcription, such as AFF4, CDK9, MEPCE, INTS12, NCBP1, POLR2M/GDOWN1 and SUPT6H. The PNUTS-PP1 complex also regulates transcription termination by mediating dephosphorylation of SUPT5H in termination zones downstream of poly(A) sites, thereby promoting deceleration of RNA polymerase II transcription. PNUTS-PP1 complex is also involved in the response to replication stress by mediating dephosphorylation of POLR2A at 'Ser-5' of the CTD, promoting RNA polymerase II degradation. PNUTS-PP1 also plays a role in the control of chromatin structure and cell cycle progression during the transition from mitosis into interphase. Regulates NEK2 function in terms of kinase activity and centrosome number and splitting, both in the presence and absence of radiation-induced DNA damage. Regulator of neural tube and optic fissure closure, and enteric neural crest cell (ENCCs) migration during development. In balance with CSNK1D and CSNK1E, determines the circadian period length, through the regulation of the speed and rhythmicity of PER1 and PER2 phosphorylation. May dephosphorylate CSNK1D and CSNK1E. Dephosphorylates the 'Ser-418' residue of FOXP3 in regulatory T-cells (Treg) from patients with rheumatoid arthritis, thereby inactivating FOXP3 and rendering Treg cells functionally defective. Dephosphorylates CENPA. Dephosphorylates the 'Ser-139' residue of ATG16L1 causing dissociation of ATG12-ATG5-ATG16L1 complex, thereby inhibiting autophagy. Together with PPP1CC (PP1-gamma subunit), dephosphorylates IFIH1/MDA5 and RIG-I leading to their activation and a functional innate immune response. Core component of the SHOC2-MRAS-PP1c (SMP) holophosphatase complex that regulates the MAPK pathway activation. The SMP complex specifically dephosphorylates the inhibitory phosphorylation at 'Ser-259' of RAF1 kinase, 'Ser-365' of BRAF kinase and 'Ser-214' of ARAF kinase, stimulating their kinase activities. The SMP complex enhances the dephosphorylation activity and substrate specificity of PP1c.; FUNCTION: (Microbial infection) Necessary for alphaviruses replication.
Molecular Weight
32kDa/37kDa/38kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBIHCELISA
Clone
ARC62062
Isotype
IgG
Form
Liquid
Immunogen
Synthetic peptide. This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
HumanMouseRat
Back to Product Catalog