Antibodies
Anti-Phospho-RPS6-S235 Antibody-Oligo Conjugate
SKU: aoc3978
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Phospho-RPS6-S235 Antibody-IF1
Antibody Target
- Target
- Small ribosomal subunit protein eS6
- UniProt Number
- P62753
- Target Description
- Component of the 40S small ribosomal subunit. Plays an important role in controlling cell growth and proliferation through the selective translation of particular classes of mRNA. Part of the small subunit (SSU) processome, first precursor of the small eukaryotic ribosomal subunit. During the assembly of the SSU processome in the nucleolus, many ribosome biogenesis factors, an RNA chaperone and ribosomal proteins associate with the nascent pre-rRNA and work in concert to generate RNA folding, modifications, rearrangements and cleavage as well as targeted degradation of pre-ribosomal RNA by the RNA exosome.
- Molecular Weight
- 29kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC66157
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat