Antibodies
Anti-Phospho-STAT1-S727 Antibody-Oligo Conjugate
SKU: aoc4098
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Phospho-STAT1-S727 Antibody-IF1
Antibody Target
- Target
- Signal transducer and activator of transcription 1-alpha/beta
- UniProt Number
- P42224
- Target Description
- Signal transducer and transcription activator that mediates cellular responses to interferons (IFNs), cytokine KITLG/SCF and other cytokines and other growth factors. Following type I IFN (IFN-alpha and IFN-beta) binding to cell surface receptors, signaling via protein kinases leads to activation of Jak kinases (TYK2 and JAK1) and to tyrosine phosphorylation of STAT1 and STAT2. The phosphorylated STATs dimerize and associate with ISGF3G/IRF-9 to form a complex termed ISGF3 transcription factor, that enters the nucleus. ISGF3 binds to the IFN stimulated response element (ISRE) to activate the transcription of IFN-stimulated genes (ISG), which drive the cell in an antiviral state. In response to type II IFN (IFN-gamma), STAT1 is tyrosine- and serine-phosphorylated. It then forms a homodimer termed IFN-gamma-activated factor (GAF), migrates into the nucleus and binds to the IFN gamma activated sequence (GAS) to drive the expression of the target genes, inducing a cellular antiviral state. Becomes activated in response to KITLG/SCF and KIT signaling. May mediate cellular responses to activated FGFR1, FGFR2, FGFR3 and FGFR4. Following bacterial lipopolysaccharide (LPS)-induced TLR4 endocytosis, phosphorylated at Thr-749 by IKBKB which promotes binding of STAT1 to the 5'-TTTGAGGC-3' sequence in the ARID5A promoter, resulting in transcriptional activation of ARID5A and subsequent ARID5A-mediated stabilization of IL6. Phosphorylation at Thr-749 also promotes binding of STAT1 to the 5'-TTTGAGTC-3' sequence in the IL12B promoter and activation of IL12B transcription. Involved in food tolerance in small intestine: associates with the Gasdermin-D, p13 cleavage product (13 kDa GSDMD) and promotes transcription of CIITA, inducing type 1 regulatory T (Tr1) cells in upper small intestine.
- Molecular Weight
- 87kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCIHCELISA
- Clone
- ARC1544
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat