Antibodies
Anti-Phospho-ULK1-S555 Antibody-Oligo Conjugate
SKU: aoc3892
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Phospho-ULK1-S555 Antibody-IF1
Antibody Target
- Target
- Serine/threonine-protein kinase ULK1
- UniProt Number
- O75385
- Target Description
- Serine/threonine-protein kinase involved in autophagy in response to starvation. Acts upstream of phosphatidylinositol 3-kinase PIK3C3 to regulate the formation of autophagophores, the precursors of autophagosomes. Part of regulatory feedback loops in autophagy: acts both as a downstream effector and negative regulator of mammalian target of rapamycin complex 1 (mTORC1) via interaction with RPTOR. Activated via phosphorylation by AMPK and also acts as a regulator of AMPK by mediating phosphorylation of AMPK subunits PRKAA1, PRKAB2 and PRKAG1, leading to negatively regulate AMPK activity. May phosphorylate ATG13/KIAA0652 and RPTOR; however such data need additional evidences. Plays a role early in neuronal differentiation and is required for granule cell axon formation. Also phosphorylates SESN2 and SQSTM1 to regulate autophagy. Phosphorylates FLCN, promoting autophagy. Phosphorylates AMBRA1 in response to autophagy induction, releasing AMBRA1 from the cytoskeletal docking site to induce autophagosome nucleation. Phosphorylates ATG4B, leading to inhibit autophagy by decreasing both proteolytic activation and delipidation activities of ATG4B.
- Molecular Weight
- 113kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC63423
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouse