Antibodies
Anti-Phospho-VASP-S239 Antibody-Oligo Conjugate
SKU: aoc3999
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Phospho-VASP-S239 Antibody-IF1
Antibody Target
- Target
- Vasodilator-stimulated phosphoprotein
- UniProt Number
- P50552
- Target Description
- Ena/VASP proteins are actin-associated proteins involved in a range of processes dependent on cytoskeleton remodeling and cell polarity such as axon guidance, lamellipodial and filopodial dynamics, platelet activation and cell migration. VASP promotes actin filament elongation. It protects the barbed end of growing actin filaments against capping and increases the rate of actin polymerization in the presence of capping protein. VASP stimulates actin filament elongation by promoting the transfer of profilin-bound actin monomers onto the barbed end of growing actin filaments. Plays a role in actin-based mobility of Listeria monocytogenes in host cells. Regulates actin dynamics in platelets and plays an important role in regulating platelet aggregation.
- Molecular Weight
- 40kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC65969
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human