Antibodies
Anti-Phospho-ZAP70-Y493 Antibody-Oligo Conjugate
SKU: aoc4103
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-Phospho-ZAP70-Y493 Antibody-IF1
Antibody Target
- Target
- Tyrosine-protein kinase ZAP-70
- UniProt Number
- P43403
- Target Description
- Tyrosine kinase that plays an essential role in regulation of the adaptive immune response. Regulates motility, adhesion and cytokine expression of mature T-cells, as well as thymocyte development. Also contributes to the development and activation of primary B-lymphocytes. When antigen presenting cells (APC) activate T-cell receptor (TCR), a serie of phosphorylations lead to the recruitment of ZAP70 to the doubly phosphorylated TCR component CD247/CD3Z through ITAM motif at the plasma membrane. This recruitment serves to localization to the stimulated TCR and to relieve its autoinhibited conformation. Release of ZAP70 active conformation is further stabilized by phosphorylation mediated by LCK. Subsequently, ZAP70 phosphorylates at least 2 essential adapter proteins: LAT and LCP2. In turn, a large number of signaling molecules are recruited and ultimately lead to lymphokine production, T-cell proliferation and differentiation. Furthermore, ZAP70 controls cytoskeleton modifications, adhesion and mobility of T-lymphocytes, thus ensuring correct delivery of effectors to the APC. ZAP70 is also required for TCR-CD247/CD3Z internalization and degradation through interaction with the E3 ubiquitin-protein ligase CBL and adapter proteins SLA and SLA2. Thus, ZAP70 regulates both T-cell activation switch on and switch off by modulating TCR expression at the T-cell surface. During thymocyte development, ZAP70 promotes survival and cell-cycle progression of developing thymocytes before positive selection (when cells are still CD4/CD8 double negative). Additionally, ZAP70-dependent signaling pathway may also contribute to primary B-cells formation and activation through B-cell receptor (BCR).
- Molecular Weight
- 70kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- ICCELISA
- Clone
- ARC59392
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human