Antibodies
Anti-PI 3 Kinase catalytic subunit alpha Antibody-Oligo Conjugate
SKU: aoc3096
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-PI 3 Kinase catalytic subunit alpha Antibody-PLA1
Antibody Target
- Target
- Phosphatidylinositol 4,5-bisphosphate 3-kinase catalytic subunit alpha isoform
- UniProt Number
- P42336
- Target Description
- Phosphoinositide-3-kinase (PI3K) phosphorylates phosphatidylinositol (PI) and its phosphorylated derivatives at position 3 of the inositol ring to produce 3-phosphoinositides. Uses ATP and PtdIns(4,5)P2 (phosphatidylinositol 4,5-bisphosphate) to generate phosphatidylinositol 3,4,5-trisphosphate (PIP3). PIP3 plays a key role by recruiting PH domain-containing proteins to the membrane, including AKT1 and PDPK1, activating signaling cascades involved in cell growth, survival, proliferation, motility and morphology. Participates in cellular signaling in response to various growth factors. Involved in the activation of AKT1 upon stimulation by receptor tyrosine kinases ligands such as EGF, insulin, IGF1, VEGFA and PDGF. Involved in signaling via insulin-receptor substrate (IRS) proteins. Essential in endothelial cell migration during vascular development through VEGFA signaling, possibly by regulating RhoA activity. Required for lymphatic vasculature development, possibly by binding to RAS and by activation by EGF and FGF2, but not by PDGF. Regulates invadopodia formation through the PDPK1-AKT1 pathway. Participates in cardiomyogenesis in embryonic stem cells through a AKT1 pathway. Participates in vasculogenesis in embryonic stem cells through PDK1 and protein kinase C pathway. In addition to its lipid kinase activity, it displays a serine-protein kinase activity that results in the autophosphorylation of the p85alpha regulatory subunit as well as phosphorylation of other proteins such as 4EBP1, H-Ras, the IL-3 beta c receptor and possibly others. Plays a role in the positive regulation of phagocytosis and pinocytosis.
- Molecular Weight
- 124kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISA
- Clone
- ARC58257
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat