Antibodies
Anti-PI3 Kinase p85 alpha/beta Antibody-Oligo Conjugate
SKU: aoc3101
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PI3 Kinase p85 alpha/beta Antibody-IF1
Antibody Target
- Target
- Phosphatidylinositol 3-kinase regulatory subunit alpha
- Additional Target Information
- This antibody also binds Phosphatidylinositol 3-kinase regulatory subunit beta, Uniprot:O00459.
- UniProt Number
- P27986
- Target Description
- Binds to activated (phosphorylated) protein-Tyr kinases, through its SH2 domain, and acts as an adapter, mediating the association of the p110 catalytic unit to the plasma membrane. Necessary for the insulin-stimulated increase in glucose uptake and glycogen synthesis in insulin-sensitive tissues. Plays an important role in signaling in response to FGFR1, FGFR2, FGFR3, FGFR4, KITLG/SCF, KIT, PDGFRA and PDGFRB. Likewise, plays a role in ITGB2 signaling. Modulates the cellular response to ER stress by promoting nuclear translocation of XBP1 isoform 2 in a ER stress- and/or insulin-dependent manner during metabolic overloading in the liver and hence plays a role in glucose tolerance improvement.
- Molecular Weight
- 42-54 kDa/81-84 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat