Antibodies
Anti-PIAS1+PIAS2 Antibody-Oligo Conjugate
SKU: aoc3103
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PIAS1+PIAS2 Antibody-IF1
Antibody Target
- Target
- E3 SUMO-protein ligase PIAS1
- Additional Target Information
- This antibody also binds E3 SUMO-protein ligase PIAS2, Uniprot:O75928.
- UniProt Number
- O75925
- Target Description
- Functions as an E3-type small ubiquitin-like modifier (SUMO) ligase, stabilizing the interaction between UBE2I and the substrate, and as a SUMO-tethering factor. Catalyzes sumoylation of various proteins, such as CEBPB, MRE11, MTA1, PTK2 and PML. Plays a crucial role as a transcriptional coregulation in various cellular pathways, including the STAT pathway, the p53 pathway and the steroid hormone signaling pathway. In vitro, binds A/T-rich DNA. The effects of this transcriptional coregulation, transactivation or silencing, may vary depending upon the biological context. Mediates sumoylation of MRE11, stabilizing MRE11 on chromatin during end resection. Sumoylates PML (at 'Lys-65' and 'Lys-160') and PML-RAR and promotes their ubiquitin-mediated degradation. PIAS1-mediated sumoylation of PML promotes its interaction with CSNK2A1/CK2 which in turn promotes PML phosphorylation and degradation. Enhances the sumoylation of MTA1 and may participate in its paralog-selective sumoylation. Plays a dynamic role in adipogenesis by promoting the SUMOylation and degradation of CEBPB. Mediates the nuclear mobility and localization of MSX1 to the nuclear periphery, whereby MSX1 is brought into the proximity of target myoblast differentiation factor genes. Also required for the binding of MSX1 to the core enhancer region in target gene promoter regions, independent of its sumoylation activity. Capable of binding to the core enhancer region TAAT box in the MYOD1 gene promoter.; FUNCTION: (Microbial infection) Restricts Epstein-Barr virus (EBV) lytic replication by acting as an inhibitor for transcription factors involved in lytic gene expression. The virus can use apoptotic caspases to antagonize PIAS1-mediated restriction and express its lytic genes.
- Molecular Weight
- 76kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1690
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat