Antibodies

Anti-PIM1 Antibody-Oligo Conjugate

SKU: aoc3106

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-PIM1 Antibody-IF1

Antibody Target

Target
Serine/threonine-protein kinase pim-1
UniProt Number
P11309
Target Description
Proto-oncogene with serine/threonine kinase activity involved in cell survival and cell proliferation and thus providing a selective advantage in tumorigenesis. Exerts its oncogenic activity through: the regulation of MYC transcriptional activity, the regulation of cell cycle progression and by phosphorylation and inhibition of proapoptotic proteins (BAD, MAP3K5, FOXO3). Phosphorylation of MYC leads to an increase of MYC protein stability and thereby an increase of transcriptional activity. The stabilization of MYC exerted by PIM1 might explain partly the strong synergism between these two oncogenes in tumorigenesis. Mediates survival signaling through phosphorylation of BAD, which induces release of the anti-apoptotic protein Bcl-X(L)/BCL2L1. Phosphorylation of MAP3K5, another proapoptotic protein, by PIM1, significantly decreases MAP3K5 kinase activity and inhibits MAP3K5-mediated phosphorylation of JNK and JNK/p38MAPK subsequently reducing caspase-3 activation and cell apoptosis. Stimulates cell cycle progression at the G1-S and G2-M transitions by phosphorylation of CDC25A and CDC25C. Phosphorylation of CDKN1A, a regulator of cell cycle progression at G1, results in the relocation of CDKN1A to the cytoplasm and enhanced CDKN1A protein stability. Promotes cell cycle progression and tumorigenesis by down-regulating expression of a regulator of cell cycle progression, CDKN1B, at both transcriptional and post-translational levels. Phosphorylation of CDKN1B, induces 14-3-3 proteins binding, nuclear export and proteasome-dependent degradation. May affect the structure or silencing of chromatin by phosphorylating HP1 gamma/CBX3. Also acts as a regulator of homing and migration of bone marrow cells involving functional interaction with the CXCL12-CXCR4 signaling axis. Acts as a positive regulator of mTORC1 signaling by mediating phosphorylation and inhibition of DEPDC5 component of the GATOR1 complex. Acts as a negative regulator of innate immunity by mediating phosphorylation and inactivation of GBP1 in absence of infection: phosphorylation of GBP1 induces interaction with 14-3-3 protein sigma (SFN) and retention in the cytosol. Also phosphorylates and activates the ATP-binding cassette transporter ABCG2, allowing resistance to drugs through their excretion from cells. Promotes brown adipocyte differentiation.
Molecular Weight
36kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBIHCELISA
Clone
ARC0175
Isotype
IgG
Form
Liquid
Immunogen
Synthetic peptide. This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
HumanMouseRat