Antibodies
Anti-PIM2 Antibody-Oligo Conjugate (ARC1485)
SKU: aoc3107
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-PIM2 Antibody (ARC1485)-PLA1
Antibody Target
- Target
- Serine/threonine-protein kinase pim-2
- UniProt Number
- Q9P1W9
- Target Description
- Proto-oncogene with serine/threonine kinase activity involved in cell survival and cell proliferation. Exerts its oncogenic activity through: the regulation of MYC transcriptional activity, the regulation of cell cycle progression, the regulation of cap-dependent protein translation and through survival signaling by phosphorylation of a pro-apoptotic protein, BAD. Phosphorylation of MYC leads to an increase of MYC protein stability and thereby an increase transcriptional activity. The stabilization of MYC exerted by PIM2 might explain partly the strong synergism between these 2 oncogenes in tumorigenesis. Regulates cap-dependent protein translation in a mammalian target of rapamycin complex 1 (mTORC1)-independent manner and in parallel to the PI3K-Akt pathway. Mediates survival signaling through phosphorylation of BAD, which induces release of the anti-apoptotic protein Bcl-X(L)/BCL2L1. Promotes cell survival in response to a variety of proliferative signals via positive regulation of the I-kappa-B kinase/NF-kappa-B cascade; this process requires phosphorylation of MAP3K8/COT. Promotes growth factor-independent proliferation by phosphorylation of cell cycle factors such as CDKN1A and CDKN1B. Involved in the positive regulation of chondrocyte survival and autophagy in the epiphyseal growth plate.
- Molecular Weight
- 34kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPELISA
- Clone
- ARC1485
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human