Antibodies
Anti-PIST Antibody-Oligo Conjugate
SKU: aoc3112
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PIST Antibody-IF1
Antibody Target
- Target
- Golgi-associated PDZ and coiled-coil motif-containing protein
- UniProt Number
- Q9HD26
- Target Description
- Plays a role in intracellular protein trafficking and degradation. May regulate CFTR chloride currents and acid-induced ASIC3 currents by modulating cell surface expression of both channels. May also regulate the intracellular trafficking of the ADR1B receptor. May play a role in autophagy. Together with MARCHF2 mediates the ubiquitination and lysosomal degradation of CFTR. Overexpression results in CFTR intracellular retention and lysosomaldegradation in the lysosomes.
- Molecular Weight
- 51kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCICCELISA
- Clone
- ARC1831
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat