Antibodies
Anti-PIWIL1 Antibody-Oligo Conjugate
SKU: aoc3117
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PIWIL1 Antibody-IF1
Antibody Target
- Target
- Piwi-like protein 1
- UniProt Number
- Q96J94
- Target Description
- Endoribonuclease that plays a central role in postnatal germ cells by repressing transposable elements and preventing their mobilization, which is essential for the germline integrity. Acts via the piRNA metabolic process, which mediates the repression of transposable elements during meiosis by forming complexes composed of piRNAs and Piwi proteins and governs the methylation and subsequent repression of transposons. Directly binds methylated piRNAs, a class of 24 to 30 nucleotide RNAs that are generated by a Dicer-independent mechanism and are primarily derived from transposons and other repeated sequence elements. Strongly prefers a uridine in the first position of their guide (g1U preference, also named 1U-bias). Not involved in the piRNA amplification loop, also named ping-pong amplification cycle. Acts as an endoribonuclease that cleaves transposon messenger RNAs. Besides their function in transposable elements repression, piRNAs are probably involved in other processes during meiosis such as translation regulation. Probable component of some RISC complex, which mediates RNA cleavage and translational silencing. Also plays a role in the formation of chromatoid bodies and is required for some miRNAs stability. Required to sequester RNF8 in the cytoplasm until late spermatogenesis; RNF8 being released upon ubiquitination and degradation of PIWIL1.; FUNCTION: [Isoform 3]: May be a negative developmental regulator.
- Molecular Weight
- 99kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIF-PIHCELISA
- Clone
- ARC0786
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- MouseRat