Antibodies
Anti-PIWIL4 Antibody-Oligo Conjugate
SKU: aoc3118
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PIWIL4 Antibody-IF1
Antibody Target
- Target
- Piwi-like protein 4
- UniProt Number
- Q7Z3Z4
- Target Description
- Plays a central role during spermatogenesis by repressing transposable elements and preventing their mobilization, which is essential for the germline integrity. Acts via the piRNA metabolic process, which mediates the repression of transposable elements during meiosis by forming complexes composed of piRNAs and Piwi proteins. The PIWIL4-piRNA pathway acts in the nucleus and mediates silencing of active transposons: engages with nascent transposable element transcripts and governs the piRNA-directed DNA methylation and subsequent repression of transposons. In contrast to PIWIL1 and PIWIL2, does not show endonuclease activity. Directly binds piRNAs, a class of 24 to 30 nucleotide RNAs that are generated by a Dicer-independent mechanism and are primarily derived from transposons and other repeated sequence elements. Associates with secondary piRNAs antisense and PIWIL2/MILI is required for such association. The piRNA process acts upstream of known mediators of DNA methylation. Plays a key role in the piRNA amplification loop, also named ping-pong amplification cycle, by acting as a 'slicer-incompetent' component that loads cleaved piRNAs from the 'slicer-competent' component PIWIL2 and target them on genomic transposon loci in the nucleus. May be involved in the chromatin-modifying pathway by inducing 'Lys-9' methylation of histone H3 at some loci. In addition to its role in germline, PIWIL4 also plays a role in the regulation of somatic cells activities. Plays a role in pancreatic beta cell function and insulin secretion. Involved in maintaining cell morphology and functional integrity of retinal epithelial through Akt/GSK3alpha/beta signaling pathway. When overexpressed, acts as an oncogene by inhibition of apoptosis and promotion of cells proliferation in tumors.
- Molecular Weight
- 97kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC60300
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat