Antibodies

Anti-PKM2 Antibody-Oligo Conjugate

SKU: aoc3131

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-PKM2 Antibody-IF1

Antibody Target

Target
Pyruvate kinase PKM
UniProt Number
P14618
Target Description
Catalyzes the final rate-limiting step of glycolysis by mediating the transfer of a phosphoryl group from phosphoenolpyruvate (PEP) to ADP, generating ATP. The ratio between the highly active tetrameric form and nearly inactive dimeric form determines whether glucose carbons are channeled to biosynthetic processes or used for glycolytic ATP production. The transition between the 2 forms contributes to the control of glycolysis and is important for tumor cell proliferation and survival.; FUNCTION: [Isoform M2]: Isoform specifically expressed during embryogenesis that has low pyruvate kinase activity by itself and requires allosteric activation by D-fructose 1,6-bisphosphate (FBP) for pyruvate kinase activity. In addition to its pyruvate kinase activity in the cytoplasm, also acts as a regulator of transcription in the nucleus by acting as a protein kinase. Translocates into the nucleus in response to various signals, such as EGF receptor activation, and homodimerizes, leading to its conversion into a protein threonine- and tyrosine-protein kinase. Catalyzes phosphorylation of STAT3 at 'Tyr-705' and histone H3 at 'Thr-11' (H3T11ph), leading to activate transcription. Its ability to activate transcription plays a role in cancer cells by promoting cell proliferation and promote tumorigenesis. Promotes the expression of the immune checkpoint protein CD274 in BMAL1-deficient macrophages. May also act as a translation regulator for a subset of mRNAs, independently of its pyruvate kinase activity: associates with subpools of endoplasmic reticulum-associated ribosomes, binds directly to the mRNAs translated at the endoplasmic reticulum and promotes translation of these endoplasmic reticulum-destined mRNAs. Plays a role in caspase independent cell death of tumor cells.; FUNCTION: [Isoform M1]: Pyruvate kinase isoform expressed in adult tissues, which replaces isoform M2 after birth. In contrast to isoform M2, has high pyruvate kinase activity by itself and does not require allosteric activation by D-fructose 1,6-bisphosphate (FBP) for activity.
Molecular Weight
58kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBICCIF-PIHCELISA
Isotype
IgG
Form
Liquid
Immunogen
Synthetic peptide. This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
HumanMouseRat