Antibodies
Anti-PKR Antibody-Oligo Conjugate
SKU: aoc3134
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PKR Antibody-IF1
Antibody Target
- Target
- Interferon-induced, double-stranded RNA-activated protein kinase
- UniProt Number
- P19525
- Target Description
- IFN-induced dsRNA-dependent serine/threonine-protein kinase that phosphorylates the alpha subunit of eukaryotic translation initiation factor 2 (EIF2S1/eIF-2-alpha) and plays a key role in the innate immune response to viral infection. Inhibits viral replication via the integrated stress response (ISR): EIF2S1/eIF-2-alpha phosphorylation in response to viral infection converts EIF2S1/eIF-2-alpha in a global protein synthesis inhibitor, resulting to a shutdown of cellular and viral protein synthesis, while concomitantly initiating the preferential translation of ISR-specific mRNAs, such as the transcriptional activator ATF4. Exerts its antiviral activity on a wide range of DNA and RNA viruses including hepatitis C virus (HCV), hepatitis B virus (HBV), measles virus (MV) and herpes simplex virus 1 (HHV-1). Also involved in the regulation of signal transduction, apoptosis, cell proliferation and differentiation: phosphorylates other substrates including p53/TP53, PPP2R5A, DHX9, ILF3, IRS1 and the HHV-1 viral protein US11. In addition to serine/threonine-protein kinase activity, also has tyrosine-protein kinase activity and phosphorylates CDK1 at 'Tyr-4' upon DNA damage, facilitating its ubiquitination and proteasomal degradation. Either as an adapter protein and/or via its kinase activity, can regulate various signaling pathways (p38 MAP kinase, NF-kappa-B and insulin signaling pathways) and transcription factors (JUN, STAT1, STAT3, IRF1, ATF3) involved in the expression of genes encoding pro-inflammatory cytokines and IFNs. Activates the NF-kappa-B pathway via interaction with IKBKB and TRAF family of proteins and activates the p38 MAP kinase pathway via interaction with MAP2K6. Can act as both a positive and negative regulator of the insulin signaling pathway (ISP). Negatively regulates ISP by inducing the inhibitory phosphorylation of insulin receptor substrate 1 (IRS1) at 'Ser-312' and positively regulates ISP via phosphorylation of PPP2R5A which activates FOXO1, which in turn up-regulates the expression of insulin receptor substrate 2 (IRS2). Can regulate NLRP3 inflammasome assembly and the activation of NLRP3, NLRP1, AIM2 and NLRC4 inflammasomes. Plays a role in the regulation of the cytoskeleton by binding to gelsolin (GSN), sequestering the protein in an inactive conformation away from actin.
- Molecular Weight
- 62 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC0024
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human