Antibodies

Anti-PKR Antibody-Oligo Conjugate

SKU: aoc3134

Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.

Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.

Choose AbOliGo for...

  • Consistent conjugation performance
  • Flexible antibody and oligo pairing
  • Fast conjugation turn around time
  • Trusted expertise in oligo design

Choose Oligo Conjugate

Assay

Immunofluorescence Oligossee protocol

IF1 Oligo Details

5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'

View Paper

Accessory oligo is complementary to only the ab-conjugated oligo

Anti-PKR Antibody-IF1

Antibody Target

Target
Interferon-induced, double-stranded RNA-activated protein kinase
UniProt Number
P19525
Target Description
IFN-induced dsRNA-dependent serine/threonine-protein kinase that phosphorylates the alpha subunit of eukaryotic translation initiation factor 2 (EIF2S1/eIF-2-alpha) and plays a key role in the innate immune response to viral infection. Inhibits viral replication via the integrated stress response (ISR): EIF2S1/eIF-2-alpha phosphorylation in response to viral infection converts EIF2S1/eIF-2-alpha in a global protein synthesis inhibitor, resulting to a shutdown of cellular and viral protein synthesis, while concomitantly initiating the preferential translation of ISR-specific mRNAs, such as the transcriptional activator ATF4. Exerts its antiviral activity on a wide range of DNA and RNA viruses including hepatitis C virus (HCV), hepatitis B virus (HBV), measles virus (MV) and herpes simplex virus 1 (HHV-1). Also involved in the regulation of signal transduction, apoptosis, cell proliferation and differentiation: phosphorylates other substrates including p53/TP53, PPP2R5A, DHX9, ILF3, IRS1 and the HHV-1 viral protein US11. In addition to serine/threonine-protein kinase activity, also has tyrosine-protein kinase activity and phosphorylates CDK1 at 'Tyr-4' upon DNA damage, facilitating its ubiquitination and proteasomal degradation. Either as an adapter protein and/or via its kinase activity, can regulate various signaling pathways (p38 MAP kinase, NF-kappa-B and insulin signaling pathways) and transcription factors (JUN, STAT1, STAT3, IRF1, ATF3) involved in the expression of genes encoding pro-inflammatory cytokines and IFNs. Activates the NF-kappa-B pathway via interaction with IKBKB and TRAF family of proteins and activates the p38 MAP kinase pathway via interaction with MAP2K6. Can act as both a positive and negative regulator of the insulin signaling pathway (ISP). Negatively regulates ISP by inducing the inhibitory phosphorylation of insulin receptor substrate 1 (IRS1) at 'Ser-312' and positively regulates ISP via phosphorylation of PPP2R5A which activates FOXO1, which in turn up-regulates the expression of insulin receptor substrate 2 (IRS2). Can regulate NLRP3 inflammasome assembly and the activation of NLRP3, NLRP1, AIM2 and NLRC4 inflammasomes. Plays a role in the regulation of the cytoskeleton by binding to gelsolin (GSN), sequestering the protein in an inactive conformation away from actin.
Molecular Weight
62 kDa

Antibody Characteristics

Clonality
Monoclonal
Application
WBICCELISA
Clone
ARC0024
Isotype
IgG
Form
Liquid
Immunogen
Synthetic peptide. This information is considered to be commercially sensitive.
Immunogen Species
Human
Host Species
Rabbit
Species Reactivity
Human