Antibodies
Anti-PLOD3 Antibody-Oligo Conjugate (ARC52018)
SKU: aoc3147
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PLOD3 Antibody (ARC52018)-IF1
Antibody Target
- Target
- Multifunctional procollagen lysine hydroxylase and glycosyltransferase LH3 [Includes: Procollagen-lysine,2-oxoglutarate 5-dioxygenase 3
- UniProt Number
- O60568
- Target Description
- Multifunctional enzyme that catalyzes a series of essential post-translational modifications on Lys residues in procollagen. Plays a redundant role in catalyzing the formation of hydroxylysine residues in -Xaa-Lys-Gly- sequences in collagens. Plays a redundant role in catalyzing the transfer of galactose onto hydroxylysine groups, giving rise to galactosyl 5-hydroxylysine. Has an essential role by catalyzing the subsequent transfer of glucose moieties, giving rise to 1,2-glucosylgalactosyl-5-hydroxylysine residues. Catalyzes hydroxylation and glycosylation of Lys residues in the MBL1 collagen-like domain, giving rise to hydroxylysine and 1,2-glucosylgalactosyl-5-hydroxylysine residues. Essential for normal biosynthesis and secretion of type IV collagens (Probable). Essential for normal formation of basement membranes.
- Molecular Weight
- 85kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC52018
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human