Antibodies
Anti-PLTP Antibody-Oligo Conjugate
SKU: aoc3150
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PLTP Antibody-IF1
Antibody Target
- Target
- Phospholipid transfer protein
- UniProt Number
- P55058
- Target Description
- Mediates the transfer of phospholipids and free cholesterol from triglyceride-rich lipoproteins (low density lipoproteins or LDL and very low density lipoproteins or VLDL) into high-density lipoproteins (HDL) as well as the exchange of phospholipids between triglyceride-rich lipoproteins themselves. Facilitates the transfer of a spectrum of different lipid molecules, including diacylglycerol, phosphatidic acid, sphingomyelin, phosphatidylcholine, phosphatidylinositol, phosphatidylglycerol, cerebroside and phosphatidyl ethanolamine. Plays an important role in HDL remodeling which involves modulating the size and composition of HDL. Also plays a key role in the uptake of cholesterol from peripheral cells and tissues that is subsequently transported to the liver for degradation and excretion. Two distinct forms of PLTP exist in plasma: an active form that can transfer phosphatidylcholine from phospholipid vesicles to HDL, and an inactive form that lacks this capability.
- Molecular Weight
- 55kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC1676
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- MouseRat