Antibodies
Anti-PLZF Antibody-Oligo Conjugate
SKU: aoc3151
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Proximity Ligation Assay Oligossee protocol
PLA1 Oligo Details
5'
[AmC6dT] ACAACAACAAGAATGGAACCTCGCTAGAACGT
3'
An AOC with the PLA2 oligo is needed to complete the pairing in a Proximity Ligation Assay.
Anti-PLZF Antibody-PLA1
Antibody Target
- Target
- Zinc finger and BTB domain-containing protein 16
- UniProt Number
- Q05516
- Target Description
- Acts as a transcriptional repressor. Transcriptional repression may be mediated through recruitment of histone deacetylases to target promoters. May play a role in myeloid maturation and in the development and/or maintenance of other differentiated tissues. Probable substrate-recognition component of an E3 ubiquitin-protein ligase complex which mediates the ubiquitination and subsequent proteasomal degradation of target proteins.
- Molecular Weight
- 74kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPIF-PELISA
- Clone
- ARC52265
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat