Antibodies
Anti-PMCA1 Antibody-Oligo Conjugate
SKU: aoc3152
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PMCA1 Antibody-IF1
Antibody Target
- Target
- Plasma membrane calcium-transporting ATPase 1
- UniProt Number
- P20020
- Target Description
- Catalyzes the hydrolysis of ATP coupled with the transport of calcium from the cytoplasm to the extracellular space thereby maintaining intracellular calcium homeostasis. Plays a role in blood pressure regulation through regulation of intracellular calcium concentration and nitric oxide production leading to regulation of vascular smooth muscle cells vasoconstriction. Positively regulates bone mineralization through absorption of calcium from the intestine. Plays dual roles in osteoclast differentiation and survival by regulating RANKL-induced calcium oscillations in preosteoclasts and mediating calcium extrusion in mature osteoclasts. Regulates insulin sensitivity through calcium/calmodulin signaling pathway by regulating AKT1 activation and NOS3 activation in endothelial cells. May play a role in synaptic transmission by modulating calcium and proton dynamics at the synaptic vesicles.
- Molecular Weight
- 135 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBICCELISA
- Clone
- ARC61750
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Synthetic peptide. This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat