Antibodies
Anti-PML Antibody-Oligo Conjugate
SKU: aoc3154
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-PML Antibody-IF1
Antibody Target
- Target
- Protein PML
- UniProt Number
- P29590
- Target Description
- Functions via its association with PML-nuclear bodies (PML-NBs) in a wide range of important cellular processes, including tumor suppression, transcriptional regulation, apoptosis, senescence, DNA damage response, and viral defense mechanisms. Acts as the scaffold of PML-NBs allowing other proteins to shuttle in and out, a process which is regulated by SUMO-mediated modifications and interactions. Inhibits EIF4E-mediated mRNA nuclear export by reducing EIF4E affinity for the 5' 7-methylguanosine (m7G) cap of target mRNAs. Isoform PML-4 has a multifaceted role in the regulation of apoptosis and growth suppression: activates RB1 and inhibits AKT1 via interactions with PP1 and PP2A phosphatases respectively, negatively affects the PI3K pathway by inhibiting MTOR and activating PTEN, and positively regulates p53/TP53 by acting at different levels (by promoting its acetylation and phosphorylation and by inhibiting its MDM2-dependent degradation). Isoform PML-4 also: acts as a transcriptional repressor of TBX2 during cellular senescence and the repression is dependent on a functional RBL2/E2F4 repressor complex, regulates double-strand break repair in gamma-irradiation-induced DNA damage responses via its interaction with WRN, acts as a negative regulator of telomerase by interacting with TERT, and regulates PER2 nuclear localization and circadian function. Isoform PML-6 inhibits specifically the activity of the tetrameric form of PKM. The nuclear isoforms (isoform PML-1, isoform PML-2, isoform PML-3, isoform PML-4 and isoform PML-5) in concert with SATB1 are involved in local chromatin-loop remodeling and gene expression regulation at the MHC-I locus. Isoform PML-2 is required for efficient IFN-gamma induced MHC II gene transcription via regulation of CIITA. Cytoplasmic PML is involved in the regulation of the TGF-beta signaling pathway. PML also regulates transcription activity of ELF4 and can act as an important mediator for TNF-alpha- and IFN-alpha-mediated inhibition of endothelial cell network formation and migration.; FUNCTION: Exhibits antiviral activity against both DNA and RNA viruses. The antiviral activity can involve one or several isoform(s) and can be enhanced by the permanent PML-NB-associated protein DAXX or by the recruitment of p53/TP53 within these structures. Isoform PML-4 restricts varicella zoster virus (VZV) via sequestration of virion capsids in PML-NBs thereby preventing their nuclear egress and inhibiting formation of infectious virus particles. The sumoylated isoform PML-4 restricts rabies virus by inhibiting viral mRNA and protein synthesis. The cytoplasmic isoform PML-14 can restrict herpes simplex virus-1 (HHV-1) replication by sequestering the viral E3 ubiquitin-protein ligase ICP0 in the cytoplasm. Isoform PML-6 shows restriction activity towards human cytomegalovirus (HHV-5) and influenza A virus strains PR8(H1N1) and ST364(H3N2). Sumoylated isoform PML-4 and isoform PML-12 show antiviral activity against encephalomyocarditis virus (EMCV) by promoting nuclear sequestration of viral polymerase (P3D-POL) within PML NBs. Isoform PML-3 exhibits antiviral activity against poliovirus by inducing apoptosis in infected cells through the recruitment and the activation of p53/TP53 in the PML-NBs. Isoform PML-3 represses human foamy virus (HFV) transcription by complexing the HFV transactivator, bel1/tas, preventing its binding to viral DNA. PML may positively regulate infectious hepatitis C viral (HCV) production and isoform PML-2 may enhance adenovirus transcription. Functions as an E3 SUMO-protein ligase that sumoylates (HHV-5) immediate early protein IE1, thereby participating in the antiviral response. Isoforms PML-3 and PML-6 display the highest levels of sumoylation activity.
- Molecular Weight
- 98kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIPICCIHCELISA
- Clone
- ARC74393
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- Human