Antibodies
Anti-POLR2D Antibody-Oligo Conjugate
SKU: aoc3162
Select the oligo sequence you'd like conjugated to this antibody, and we'll deliver the antibody-oligo conjugate in record time. The antibody-oligo conjugate will be released using ensuring batch to batch consistency.
Don't see the oligo you need? Choose the 'Custom' option below to specify your oligo sequence.
Choose AbOliGo for...
- Consistent conjugation performance
- Flexible antibody and oligo pairing
- Fast conjugation turn around time
- Trusted expertise in oligo design
Choose Oligo Conjugate
Assay
Immunofluorescence Oligossee protocol
IF1 Oligo Details
5'
AATATGGAATTCGTCCGAGCCCGTCAAG
3'
Accessory oligo is complementary to only the ab-conjugated oligo
Anti-POLR2D Antibody-IF1
Antibody Target
- Target
- DNA-directed RNA polymerase II subunit RPB4
- UniProt Number
- O15514
- Target Description
- Core component of RNA polymerase II (Pol II), a DNA-dependent RNA polymerase which synthesizes mRNA precursors and many functional non-coding RNAs using the four ribonucleoside triphosphates as substrates. Pol II is the central component of the basal RNA polymerase II transcription machinery. It is composed of mobile elements that move relative to each other. POLR2D/RPB4 is part of a subcomplex with POLR2G/RPB7 that binds to a pocket formed by POLR2A/RPB1, POLR2B/RPB2 and POLR2F/RPABC2 at the base of the clamp element. The POLR2D/RPB4-POLR2G/RPB7 subcomplex seems to lock the clamp via POLR2G/RPB7 in the closed conformation thus preventing double-stranded DNA to enter the active site cleft. The POLR2D/RPB4-POLR2G/RPB7 subcomplex binds single-stranded DNA and RNA.
- Molecular Weight
- 16 kDa
Antibody Characteristics
- Clonality
- Monoclonal
- Application
- WBIHCELISA
- Clone
- ARC59739
- Isotype
- IgG
- Form
- Liquid
- Immunogen
- Recombinant protein (or fragment).This information is considered to be commercially sensitive.
- Immunogen Species
- Human
- Host Species
- Rabbit
- Species Reactivity
- HumanMouseRat